Stem-loop sequence ccr-mir-96

AccessionMI0023422 (change log)
DescriptionCyprinus carpio miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

1 open access papers mention ccr-mir-96
(1 sentences)

Stem-loop
   --c   -    ug     u         g     uu      uuuuau 
5'    ucu ucuu  ccugu uuggcacua cacau  uugcuu      a
      ||| ||||  ||||| ||||||||| |||||  ||||||      u
3'    aga agaa  gggua aaccgugau gugua  aacgag      a
   uaa   c    ca     u         -     cu      ucgcau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-96

Accession MIMAT0026326
Sequence

16 - 

uuuggcacuagcacauuuuugcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).