Stem-loop sequence ccr-mir-93

AccessionMI0023421 (change log)
DescriptionCyprinus carpio miR-93 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   cgg     -aa           g     g   cu ug 
5'    guguu   aagugcuguuu ugcag uag  g  u
      |||||   ||||||||||| ||||| |||  |   
3'    cacag   uucacgacgaa auguc auc  c  u
   -ca     cac           g     -   -u uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-93

Accession MIMAT0026325
Sequence

9 - 

aaaagugcuguuugugcagguag

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).