Stem-loop sequence ccr-mir-9

AccessionMI0023418 (change log)
DescriptionCyprinus carpio miR-9 stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention ccr-mir-9
(6 sentences)

Stem-loop
   gga      ggc     uc               g     ---   u 
5'    gggguu   uguua  uuugguuaucuagcu uauga   gug u
      ||||||   |||||  ||||||||||||||| |||||   ||| a
3'    cccuaa   acaau  aagccaauagaucga auacu   uac u
   ---      -ga     ga               a     ucu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-9-3p

Accession MIMAT0026321
Sequence

18 - 

ucuuugguuaucuagcuguaug

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-9-5p

Accession MIMAT0026322
Sequence

58 - 

uaaagcuagauaaccgaaagua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).