Stem-loop sequence ccr-mir-457b

AccessionMI0023403 (change log)
DescriptionCyprinus carpio miR-457b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --g           c   ua         ggug   g 
5'    uacuauagcag aca  aauacugga    aau u
      ||||||||||| |||  |||||||||    ||| g
3'    augaugucguc ugu  uuaugaccu    uug g
   aga           u   cg         ---a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-457b

Accession MIMAT0026303
Sequence

8 - 

agcagcacauaaauacuggag

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).