Stem-loop sequence ccr-mir-457a

AccessionMI0023402 (change log)
DescriptionCyprinus carpio miR-457a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
        a u         -uca         gcu    uc 
5' cugac g agcagcaca    auauuggca   gccc  u
   ||||| | |||||||||    |||||||||   ||||  c
3' gacug c ucgucgugu    uaugaccgu   uggg  c
        c c         uugg         ---    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-457a

Accession MIMAT0026302
Sequence

9 - 

agcagcacaucaauauuggc

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).