Stem-loop sequence ccr-mir-455

AccessionMI0023401 (change log)
DescriptionCyprinus carpio miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   augccagugu    ccu   -g     -----          u      a   c   gaa 
5'           gauc   ggu  ugagg     guaugugccc uggacu cau gug   g
             ||||   |||  |||||     |||||||||| |||||| ||| |||    
3'           cuag   ccg  acucc     cauauacggg accuga gua cac   c
   ---------u    -cu   ga     guuca          u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-455

Accession MIMAT0026301
Sequence

28 - 

uaugugcccuuggacuacaucg

 - 49

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).