Stem-loop sequence ccr-mir-26a

AccessionMI0023382 (change log)
DescriptionCyprinus carpio miR-26a stem-loop
Gene family MIPF0000043; mir-26
Literature search

3 open access papers mention ccr-mir-26a
(13 sentences)

Stem-loop
   -agu      uc   u  u         ca         gu  g 
5'     ggcugu  ccu gu caaguaauc  ggauaggcu  cu u
       ||||||  ||| || |||||||||  |||||||||  || c
3'     ccgacg  gga ca guucauuag  cuuauccgg  gg c
   uuug      gu   u  c         ua         ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-26a

Accession MIMAT0026281
Sequence

17 - 

uucaaguaauccaggauaggcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).