Stem-loop sequence ccr-mir-22a

AccessionMI0023376 (change log)
DescriptionCyprinus carpio miR-22a stem-loop
Gene family MIPF0000053; mir-22
Literature search

5 open access papers mention ccr-mir-22a
(10 sentences)

Stem-loop
   agugaauauu        u  c          -u      aa     u acc ug 
5'           ggcugacc ac gcaguucuuc  cuggca  cuuua g   c  u
             |||||||| || ||||||||||  ||||||  ||||| |   |   
3'           ucgacugg ug ugucaagaag  gaccgu  gaaau c   g  c
   --------uc        -  u          uc      -c     - gca uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-22a

Accession MIMAT0026275
Sequence

66 - 

aagcugccagcugaagaacugu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).