Stem-loop sequence ccr-mir-210

AccessionMI0023369 (change log)
DescriptionCyprinus carpio miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

1 open access papers mention ccr-mir-210
(1 sentences)

Stem-loop
   gugauu  ug     a   a    a   acua       u  c cc  u 
5'       uc  aaagc ggu agcc cug    acgcaca ug g  ug u
         ||  ||||| ||| |||| |||    ||||||| || |  || c
3'       ag  uuucg cca ucgg gac    ugcgugu ac c  ac u
   -----u  gu     a   a    c   agug       c  - uc  u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-210

Accession MIMAT0026268
Sequence

61 - 

cugugcgugugacagcggcu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).