Stem-loop sequence ccr-mir-199

AccessionMI0023359 (change log)
DescriptionCyprinus carpio miR-199 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention ccr-mir-199
(4 sentences)

Stem-loop
   c   auc       u        c   ---    ga 
5'  guc   ccagugu cagacuac ugu   ucag  u
    |||   ||||||| |||||||| |||   ||||  c
3'  cag   gguuaca gucugaug aca   gguc  a
   -   auu       c        -   ugu    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-199-5p

Accession MIMAT0026255
Sequence

7 - 

cccaguguucagacuaccuguuc

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-199-3p

Accession MIMAT0026256
Sequence

46 - 

acaguagucugcacauugguu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).