Stem-loop sequence ccr-mir-196b

AccessionMI0023358 (change log)
DescriptionCyprinus carpio miR-196b stem-loop
Gene family MIPF0000031; mir-196
Literature search

2 open access papers mention ccr-mir-196b
(6 sentences)

Stem-loop
   ca      ucu ug               a   g   ggc    cgu 
5'   agcugg   g  auuuagguaguuuca guu uug   ugga   u
     ||||||   |  ||||||||||||||| ||| |||   ||||    
3'   uugacc   c  uaaguccgucaaagu caa gac   acuu   u
   --      --u gu               c   g   ---    uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-196b

Accession MIMAT0026254
Sequence

18 - 

uagguaguuucaaguuguuggg

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).