Stem-loop sequence ccr-mir-196a

AccessionMI0023357 (change log)
DescriptionCyprinus carpio miR-196a stem-loop
Gene family MIPF0000031; mir-196
Literature search

2 open access papers mention ccr-mir-196a
(6 sentences)

Stem-loop
   --uggu        u          a          a ug c 
5'       gcgugguu agguaguuuc uguuguuggg u  g u
         |||||||| |||||||||| |||||||||| |  |  
3'       ugcauuag uccgucaaag acaacagcuc g  u u
   cuugac        u          a          - gu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-196a

Accession MIMAT0026253
Sequence

13 - 

uagguaguuucauguuguuggg

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).