Stem-loop sequence ccr-mir-18a

AccessionMI0023350 (change log)
DescriptionCyprinus carpio miR-18a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   cu    u   uc   u    a   -  -a  u 
5'   aagg gca  uag gcag uag ug  ag a
     |||| |||  ||| |||| ||| ||  ||  
3'   uucc cgu  auc cguc auc ac  uc g
   -c    u   ga   c    -   c  ga  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-18a

Accession MIMAT0026246
Sequence

2 - 

uaaggugcaucuagugcagauag

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).