Stem-loop sequence ccr-mir-181c

AccessionMI0023345 (change log)
DescriptionCyprinus carpio miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

2 open access papers mention ccr-mir-181c
(7 sentences)

Stem-loop
   cu     c  a   a         cug          uuau 
5'   ggguc ug uuc cauucauug   ucgguggguu    c
     ||||| || ||| |||||||||   ||||||||||     
3'   cccgg au aag guaaguaac   ggccgcucag    u
   --     u  c   a         --a          cuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-181c

Accession MIMAT0026240
Sequence

14 - 

cacauucauugcugucgguggg

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).