Stem-loop sequence ccr-mir-181b

AccessionMI0023344 (change log)
DescriptionCyprinus carpio miR-181b stem-loop
Gene family MIPF0000007; mir-181
Literature search

2 open access papers mention ccr-mir-181b
(7 sentences)

Stem-loop
   aaug      auaaa         cu           uuaaa 
5'     acugca     cauucauug  gucgguggguu     u
       ||||||     |||||||||  |||||||||||      
3'     uggcgu     guaaguaac  uagucacucaa     u
   -acg      caaac         --           cacag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-181b

Accession MIMAT0026239
Sequence

14 - 

aacauucauugcugucggugg

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).