Stem-loop sequence ccr-mir-17

AccessionMI0023342 (change log)
DescriptionCyprinus carpio miR-17 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ucaa        -ca        a  g     g   -    a 
5'     uguauugu   aagugcuu ca ugcag uag uauu u
       ||||||||   |||||||| || ||||| ||| ||||  
3'     auauaacg   uucacgga gu acguc auc auaa g
   ----        auc        g  g     -   u    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-17-5p

Accession MIMAT0026236
Sequence

13 - 

caaagugcuuacagugcagguag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-17-3p

Accession MIMAT0026237
Sequence

51 - 

acugcaguggaggcacuucuagc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).