Stem-loop sequence ccr-mir-16c

AccessionMI0023341 (change log)
DescriptionCyprinus carpio miR-16c stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
                     -ua         guuacuccuu   a 
5' ucuugcuuuagcagcaug   aauauugga          ggc a
   ||||||||||||||||||   |||||||||          |||  
3' agaacgaagucgucguac   uuauaaccu          ccg a
                     ucg         ----------   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-16c

Accession MIMAT0026235
Sequence

9 - 

uagcagcauguaaauauugga

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).