Stem-loop sequence ccr-mir-16a

AccessionMI0023339 (change log)
DescriptionCyprinus carpio miR-16a stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ccr-mir-16a
(1 sentences)

Stem-loop
   acucua   c       uu         -ua        u u   aaa  c 
5'       ccu ccucgcu  agcagcacg   aauauugg g guu   gu a
         ||| |||||||  |||||||||   |||||||| | |||   ||  
3'       gga ggaguga  ucgucgugu   uuauaacc c cga   cg a
   ------   c       cu         gug        - -   --c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-16a

Accession MIMAT0026233
Sequence

19 - 

uagcagcacguaaauauuggug

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).