Stem-loop sequence ccr-mir-15a-1

AccessionMI0023333 (change log)
DescriptionCyprinus carpio miR-15a-1 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ccr-mir-15a-1
(1 sentences)

Stem-loop
        a        ga          gugau 
5' ggugu gcagcaca  augguuugug     a
   ||||| ||||||||  ||||||||||      
3' cuacg cgucgugu  ugccggacgu     c
        a        ag          agaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-15a

Accession MIMAT0026228
Sequence

5 - 

uagcagcacagaaugguuugu

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).