Stem-loop sequence ccr-mir-146a

AccessionMI0023331 (change log)
DescriptionCyprinus carpio miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

4 open access papers mention ccr-mir-146a
(8 sentences)

Stem-loop
   a    uuaa   cu         au           ugu  a 
5'  gcac    gcc  gagaacuga  uccauagaugg   uc u
    ||||    |||  |||||||||  |||||||||||   || a
3'  ugug    cgg  uucuugacu  ggguaucuacu   ag a
   -    -uua   uc         -c           -ug  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-146a

Accession MIMAT0026226
Sequence

14 - 

ugagaacugaauuccauagaugg

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).