Stem-loop sequence cme-MIR399g

AccessionMI0023289 (change log)
DescriptionCucumis melo miR399g stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   --     uu      a        caua    cuu 
5'   agggc  cucucc uuggcagg    auga   a
     |||||  |||||| ||||||||    ||||   g
3'   ucccg  gagagg aaccgucu    uacu   a
   cu     uu      a        --ug    uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cme-miR399g

Accession MIMAT0026185
Sequence

1 - 

agggcuucucuccauuggcagg

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22375710 "Cucumis melo microRNA expression profile during aphid herbivory in a resistant and susceptible interaction" Sattar S, Song Y, Anstead JA, Sunkar R, Thompson GA Mol Plant Microbe Interact. 25:839-848(2012).