Stem-loop sequence cme-MIR828

AccessionMI0023265 (change log)
DescriptionCucumis melo miR828 stem-loop
Gene family MIPF0000544; MIR828
Stem-loop
   u                     g     uc    ---uc       caaauguc  a     aa 
5'  ugcaauguuucuugcucaaau aguau  caag     gcaccag        aa augca  c
    ||||||||||||||||||||| |||||  ||||     |||||||        || |||||   
3'  acguuguaaagaaugaguuua ucgua  guuu     cgugguu        uu uacgu  u
   a                     a     cc    uuguu       --------  a     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cme-miR828

Accession MIMAT0026161
Sequence

11 - 

ucuugcucaaaugaguauucca

 - 32

Get sequence
Evidence not experimental

References

1
"The genome of melon (Cucumis melo L.)" Garcia-Masa J, Benjak A, Sanseverino W, Bourgeois M, Mir S, González VM, Hénaff E, Câmara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutiérrez S, Blanca J, Cañizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodríguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, PNAS [in press] (2012).
2
PMID:22753475 "The genome of melon (Cucumis melo L.)" Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, Gonzalez VM, Henaff E, Camara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutierrez S, Blanca J, Canizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodriguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, Lorent Proc Natl Acad Sci U S A. 109:11872-11877(2012).