Stem-loop sequence cme-MIR399c

AccessionMI0023256 (change log)
DescriptionCucumis melo miR399c stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   -----   u        uua    a        u  caccuuccuuuuaaaacacacacacacugacacauacauauauauaua 
5'      auu cugggcaa   cucc uuggcagu gc                                                u
        ||| ||||||||   |||| |||||||| ||                                                 
3'      uaa ggcccguu   gagg aaccguca cg                                                u
   ccucg   u        -ua    a        u  cuaaaacaauaacggaauuuaaaccguuauacuaaaguguauuauaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cme-miR399c

Accession MIMAT0026152
Sequence

135 - 

ugccaaaggagauuugcccgg

 - 155

Get sequence
Evidence not experimental

References

1
"The genome of melon (Cucumis melo L.)" Garcia-Masa J, Benjak A, Sanseverino W, Bourgeois M, Mir S, González VM, Hénaff E, Câmara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutiérrez S, Blanca J, Cañizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodríguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, PNAS [in press] (2012).
2
PMID:22753475 "The genome of melon (Cucumis melo L.)" Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, Gonzalez VM, Henaff E, Camara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutierrez S, Blanca J, Canizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodriguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, Lorent Proc Natl Acad Sci U S A. 109:11872-11877(2012).