Stem-loop sequence cme-MIR396d

AccessionMI0023251 (change log)
DescriptionCucumis melo miR396d stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   -      c                         -ucugc    cccuucuucucacaaucaauuuuguaaguaaaaucucu 
5'  gccaug uuuuccacagcuuucuugaacuuuc      ucuu                                      c
    |||||| |||||||||||||||||||||||||      ||||                                       
3'  cgguac agagggugucgaaagaacuugaagg      agaa                                      u
   a      a                         uuucaa    aaaaaaaaaaaaauuuaaauugaaaacccauuuuagau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cme-miR396d

Accession MIMAT0026147
Sequence

10 - 

uuccacagcuuucuugaacuu

 - 30

Get sequence
Evidence not experimental

References

1
"The genome of melon (Cucumis melo L.)" Garcia-Masa J, Benjak A, Sanseverino W, Bourgeois M, Mir S, González VM, Hénaff E, Câmara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutiérrez S, Blanca J, Cañizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodríguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, PNAS [in press] (2012).
2
PMID:22753475 "The genome of melon (Cucumis melo L.)" Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, Gonzalez VM, Henaff E, Camara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutierrez S, Blanca J, Canizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodriguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, Lorent Proc Natl Acad Sci U S A. 109:11872-11877(2012).