Stem-loop sequence cme-MIR399f

AccessionMI0023191 (change log)
DescriptionCucumis melo miR399f stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   ---     g                  --aa   c  -     -  aauacauuuauauaaaugcauuuu 
5'    ggcag gcaauucuccuuuggcaa    aug au aaaca ca                        u
      ||||| ||||||||||||||||||    ||| || ||||| ||                         
3'    cuguc cguuaagaggaaaccguu    uac ua uuugu gu                        u
   uua     a                  guug   u  c     u  cagugagaaaagaaaauuuuuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cme-miR399f

Accession MIMAT0026087
Sequence

110 - 

ugccaaaggagaauugcac

 - 128

Get sequence
Evidence not experimental

References

1
"The genome of melon (Cucumis melo L.)" Garcia-Masa J, Benjak A, Sanseverino W, Bourgeois M, Mir S, González VM, Hénaff E, Câmara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutiérrez S, Blanca J, Cañizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodríguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, PNAS [in press] (2012).
2
PMID:22753475 "The genome of melon (Cucumis melo L.)" Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, Gonzalez VM, Henaff E, Camara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutierrez S, Blanca J, Canizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodriguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, Lorent Proc Natl Acad Sci U S A. 109:11872-11877(2012).