Stem-loop sequence mdm-MIR858

AccessionMI0023174 (change log)
DescriptionMalus domestica miR858 stem-loop
Literature search

5 open access papers mention mdm-MIR858
(71 sentences)

Stem-loop
        -u  g                  c     aaauua uc    u                    -a   ----uac    -a       g  ua    accccugaaaacccuaauuagaaaguaaucauguuuuuuuauauagauuaaucaacuugauugaccaucuaacaaauuaaacaaggcagcuucguauuauagauaacuauauauugyguagcaucuugguauuugaccucguaaccuaaauuauagaguuacuuuaaugcauaaaagagucauuaaccuagaaagaagaaaguaaauuaaaacucccaaucuuaauccuguuuaugcauuuauuggauaauucauuuggaaagugguuuagguauaucuuuuggcuccuucuuuuccuuucgaaauaugaagaagaaagcaauugaaaaaauaguaauaggcuggmuauaaguuucuaagua 
5' caugc  au cuugucaagugagcaguc uuugc      a  uuag uucguugucuguucgaccug  aac       ggua  aggcuag ua  uagu                                                                                                                                                                                                                                                                                                                                                                          c
   |||||  || |||||||||||||||||| |||||      |  |||| ||||||||||||||||||||  |||       ||||  ||||||| ||  ||||                                                                                                                                                                                                                                                                                                                                                                           
3' guacg  ug gaacaguuuacuugucag gaacg      u  aguc aagcgacagacaagcuggau  uug       ccau  uccgauc au  auca                                                                                                                                                                                                                                                                                                                                                                          c
        uu  g                  a     --aaca ga    c                    ag   uaaggua    cg       g  cg    gugaugagccagggaggaucgguguaauaaaaagauuaauuccuacaugaauaugccgaguacgauuaauaagacgucaagcuuucguucuuuuacgaaaacaccuucguugaauuagauuuaaccauugaucuaaccaaaguguagguuaaauuaaucaugucacucaaguccauaaacuauaauuucuacuaauauacagaaccauuuuuguuuuwcucguauuccgacggaugaaaaaccugaccuaaacccacacauuggauguauauauguggacuuuuuagcuauggcccgacguugacguuuuggaucccauuuucagguugcugauaguuucaauacaaucuaauggcguuucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC007244.288: 7393-8313 [+]
intergenic
Database links

Mature sequence mdm-miR858

Accession MIMAT0026070
Sequence

48 - 

uucguugucuguucgaccuga

 - 68

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).