Stem-loop sequence mdm-MIR7128

AccessionMI0023173 (change log)
DescriptionMalus domestica miR7128 stem-loop
Literature search

3 open access papers mention mdm-MIR7128
(3 sentences)

Stem-loop
                                 - -c             u 
5' ccuuuccaaucauuaacacuuaauaacgau c  aauuuuuuuuuuu g
   |||||||||||||||||||||||||||||| |  |||||||||||||  
3' ggaaagguuaguaauugugaauuauugcua g  uuaaaaaaaaaag u
                                 a cu             c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC006081.432: 212-307 [+]
intergenic
Database links

Mature sequence mdm-miR7128

Accession MIMAT0026069
Sequence

9 - 

aucauuaacacuuaauaacga

 - 29

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).