Stem-loop sequence mdm-MIR169e

AccessionMI0023171 (change log)
DescriptionMalus domestica miR169e stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention mdm-MIR169e
(9 sentences)

Stem-loop
      u     a     ag       c      u   -        au          cum  ucuccuaauucuaauccaauccaauccaag 
5' gag guaua cauga  agaagag guuguu ggu agccaagg  gacuugccug   cc                              a
   ||| ||||| |||||  ||||||| |||||| ||| ||||||||  ||||||||||   ||                              g
3' uuc cauau guacu  ucuucuc cgacag uca ucgguuuc  cuggacggac   gg                              g
      c     c     cu       -      u   a        cu          cac  acgacgacccuuuggguuguugcauccuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR169e

Accession MIMAT0026067
Sequence

13 - 

ugaagagaagagcguuguuugg

 - 34

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).