Stem-loop sequence mdm-MIR7127a

AccessionMI0023168 (change log)
DescriptionMalus domestica miR7127a stem-loop
Gene family MIPF0001408; MIR7127
Literature search

1 open access papers mention mdm-MIR7127a
(1 sentences)

Stem-loop
                  g         u      uc           ggaaccaauuuuucucccac 
5' auuggaauacucauc aauuuguca aguguu  aguuguguuau                    u
   ||||||||||||||| ||||||||| ||||||  |||||||||||                     
3' uaaccuuaugaguag uuaaacagu ucacaa  ucgacacggua                    c
                  g         c      ga           auuaacccaccauucauacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC012422.128: 844-975 [+]
intergenic
MDC021812.77: 16754-16885 [-]
intergenic
Database links

Mature sequence mdm-miR7127a

Accession MIMAT0026064
Sequence

7 - 

auacucaucgaauuugucaua

 - 27

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).