Stem-loop sequence mdm-MIR393f

AccessionMI0023167 (change log)
DescriptionMalus domestica miR393f stem-loop
Gene family MIPF0000083; MIR393
Literature search

6 open access papers mention mdm-MIR393f
(31 sentences)

Stem-loop
           u   a            u          au        u -aaa   c   cg 
5' guggaggc ucc aagggaucgcau gaucuaauug  cauauaug c    cau guc  u
   |||||||| ||| |||||||||||| ||||||||||  |||||||| |    ||| |||   
3' uaccuuug agg uucccuagcgua cuagguugau  guauauau g    gua cag  a
           c   c            -          --        u gacg   -   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR393f

Accession MIMAT0026063
Sequence

92 - 

aucaugcgaucccuucggacg

 - 112

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).