Stem-loop sequence mdm-MIR7125

AccessionMI0023163 (change log)
DescriptionMalus domestica miR7125 stem-loop
Gene family MIPF0001851; MIR7125
Literature search

3 open access papers mention mdm-MIR7125
(5 sentences)

Stem-loop
          uc    gc                    a  -   -    u   - a 
5' aaagcuc  aaau  aagcuaguuguaauaaguuc au cuu uuua ggc c g
   |||||||  ||||  |||||||||||||||||||| || ||| |||| ||| |  
3' uuuugag  uuua  uucgaucaacguuauucaag ua gaa aaau ccg g u
          uu    au                    c  c   u    c   u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC008558.180: 6437-6543 [+]
intergenic
Database links

Mature sequence mdm-miR7125

Accession MIMAT0026059
Sequence

72 - 

cgaacuuauugcaacuagcuu

 - 92

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).