Stem-loop sequence mdm-MIR319c

AccessionMI0023162 (change log)
DescriptionMalus domestica miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

4 open access papers mention mdm-MIR319c
(9 sentences)

Stem-loop
            u           uc  g   r  uuaag   ug  -a       g   ac       u   ag   u     uacaaaug 
5' aggagcucu cuucaguccag  cg ggc gu     ggc  ac  cucagcu cug  ucguugg uca  aac caucg        c
   ||||||||| |||||||||||  || ||| ||     |||  ||  ||||||| |||  ||||||| |||  ||| |||||         
3' uccucgagg gaagucagguu  gc cug cg     uug  ug  gagucga gac  agcaacc agu  uug guggu        u
            -           cu  g   a  --uua   gu  ga       g   ga       u   cu   u     gaagaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009318.175: 3694-3869 [+]
intergenic
Database links

Mature sequence mdm-miR319c-5p

Accession MIMAT0037474
Sequence

3 - 

gagcucuucuucaguccagucc

 - 24

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mdm-miR319c-3p

Accession MIMAT0026058
Sequence

112 - 

auccaacgaagcaggagcuga

 - 132

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).
2
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).