Stem-loop sequence mdm-MIR5225b

AccessionMI0023161 (change log)
DescriptionMalus domestica miR5225b stem-loop
Gene family MIPF0001388; MIR5225
Literature search

4 open access papers mention mdm-MIR5225b
(9 sentences)

Stem-loop
             -    a    u     a  u a     u  -  aa    a  uau     -     -------  gau 
5' aucaaagcgu aggg cuuc gucga gg g gaugg gc cg  ggcc ug   auugg uagcu       gc   u
   |||||||||| |||| |||| ||||| || | ||||| || ||  |||| ||   ||||| |||||       ||    
3' uaguuucgca ucuc gaag cagcu cc c cuacu cg gc  ccgg ac   uaacu aucga       cg   a
             c    c    u     -  u c     u  a  ga    -  --u     g     uauauuu  aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003092.253: 6584-6727 [+]
intergenic
Database links

Mature sequence mdm-miR5225b

Accession MIMAT0026057
Sequence

18 - 

ucugucgaaggugagauggugc

 - 39

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).