Stem-loop sequence mdm-MIR7124b

AccessionMI0023159 (change log)
DescriptionMalus domestica miR7124b stem-loop
Gene family MIPF0001579; MIR7124
Literature search

3 open access papers mention mdm-MIR7124b
(4 sentences)

Stem-loop
              a        u g                                auacuuauaaagucauuacacuagaauuuucuuugaaagaaaa 
5' auuaagcuaau acauuaua a gacacaccaauaucaacuuuauuuguucauua                                           u
   ||||||||||| |||||||| | ||||||||||||||||||||||||||||||||                                            
3' uaauucgauua uguaauau u cugugugguuauaguugaaauaaacaaguaau                                           u
              c        c g                                uaauuaugguuucgguaauuaugaauauuucaguuaugugauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR7124b

Accession MIMAT0026055
Sequence

28 - 

caccaauaucaacuuuauuug

 - 48

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).