Stem-loop sequence mdm-MIR7124a

AccessionMI0023158 (change log)
DescriptionMalus domestica miR7124a stem-loop
Gene family MIPF0001579; MIR7124
Literature search

4 open access papers mention mdm-MIR7124a
(5 sentences)

Stem-loop
                                   auacuuauaaagucauuacacuagaauuuucuuugaaagaaaa 
5' gacacaccaauaucaacuuuauuuguucauua                                           u
   ||||||||||||||||||||||||||||||||                                            
3' cugugugguuauaguugaaauaaacaaguaau                                           u
                                   uaauuaugguuucgguaauuaugaauauuucaguuaugugauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC001716.95: 7472-7623 [+]
intergenic
MDC005581.168: 2654-2805 [+]
intergenic
Database links

Mature sequence mdm-miR7124a

Accession MIMAT0026054
Sequence

5 - 

caccaauaucaacuuuauuug

 - 25

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).