Stem-loop sequence mdm-MIR159c

AccessionMI0023157 (change log)
DescriptionMalus domestica miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

11 open access papers mention mdm-MIR159c
(72 sentences)

Stem-loop
              ug      a  c       a       -u      cug  g    uu    g u    c    g      cgauaa g 
5' ggagcuccuuu  auucaa ag aggaggg gagaggg  uuuaca   cu cugg  caug a gccc ugag ugcgca      g a
   |||||||||||  |||||| || ||||||| |||||||  ||||||   || ||||  |||| | |||| |||| ||||||      |  
3' ccucgagggaa  uagguu uu uccucuc cucuucc  aagugu   ga gacc  guac u uggg auuc acgcgu      c a
              gu      c  -       -       uu      --a  g    cg    g u    a    g      ------ a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR159c

Accession MIMAT0026053
Sequence

129 - 

gaauuccuucuccucuccuuu

 - 149

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).