Stem-loop sequence mdm-MIR5225c

AccessionMI0023156 (change log)
DescriptionMalus domestica miR5225c stem-loop
Gene family MIPF0001388; MIR5225
Literature search

5 open access papers mention mdm-MIR5225c
(11 sentences)

Stem-loop
     -gaaau      u   --c   a         u   u       u  -  a    a  u 
5' uc      aucaaa cgu   ggg cuucugucg ggg gagaugg gc cg ugcc cg a
   ||      |||||| |||   ||| ||||||||| ||| ||||||| || || |||| || a
3' ag      uaguuu gua   ucc gaagacagc ucc cucuacu cg gc acgg gc u
     acaucu      c   auc   -         -   u       u  a  g    g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC011178.406: 16627-16745 [-]
intergenic
Database links

Mature sequence mdm-miR5225c

Accession MIMAT0026052
Sequence

25 - 

ucugucgugggugagauggugc

 - 46

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).