Stem-loop sequence mdm-MIR7123b

AccessionMI0023155 (change log)
DescriptionMalus domestica miR7123b stem-loop
Gene family MIPF0001602; MIR7123
Literature search

1 open access papers mention mdm-MIR7123b
(1 sentences)

Stem-loop
        au     --ac              u a    auc   uu  a    c      u         c  c   c      -ca  -    u 
5' gcuac  cgaaa    cugacgauagucac g cacu   agu  ca agag gggaug guaaaaggu ua uag ugguug   ug caug a
   |||||  |||||    |||||||||||||| | ||||   |||  || |||| |||||| ||||||||| || ||| ||||||   || ||||  
3' cggug  guuuu    gacuguuauuagug c guga   uca  gu ucuu cccuau cauuuuccg au auc accaac   gc guau a
        ac     cuuu              c c    --a   cc  g    a      c         k  u   -      aua  a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC010449.276: 9258-9440 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR7123b
mdm-MIR10996aMDC010449.276: 6773-6932 [+]
mdm-MIR7123bMDC010449.276: 9258-9440 [+]
Database links

Mature sequence mdm-miR7123b

Accession MIMAT0026051
Sequence

46 - 

aagagcgggauguguaaaagg

 - 66

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).