Stem-loop sequence mdm-MIR7121g

AccessionMI0023150 (change log)
DescriptionMalus domestica miR7121g stem-loop
Gene family MIPF0001376; MIR7121
Literature search

1 open access papers mention mdm-MIR7121g
(1 sentences)

Stem-loop
          c  c    c               cc c    ---    uu   a 
5' uauuacc uc uccu uuggugaucgcccug  c auau   gguc  cug a
   ||||||| || |||| |||||||||||||||  | ||||   ||||  |||  
3' auaaugg ag aggg aaccauuggugggac  g uaua   ccgg  gac u
          c  u    u               -a c    cgu    --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009272.679: 779-878 [-]
intergenic
Database links

Mature sequence mdm-miR7121g

Accession MIMAT0026046
Sequence

12 - 

uccucuuggugaucgcccugc

 - 32

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).