Stem-loop sequence mdm-MIR7121f

AccessionMI0023149 (change log)
DescriptionMalus domestica miR7121f stem-loop
Gene family MIPF0001376; MIR7121
Literature search

1 open access papers mention mdm-MIR7121f
(1 sentences)

Stem-loop
      uc   g        c  -  -------      cc         a 
5' ucc  uug ugaucgcc ug cc       ggccuu  ggauucggg a
   |||  ||| |||||||| || ||       ||||||  |||||||||  
3' agg  aac auuagcgg ac gg       ccggga  cuuaggucu c
      ga   g        u  a  uauacgu      --         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009272.295: 603-690 [+]
intergenic
Database links

Mature sequence mdm-miR7121f

Accession MIMAT0026045
Sequence

1 - 

uccucuuggugaucgcccugc

 - 21

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).