Stem-loop sequence mdm-MIR7121d

AccessionMI0023147 (change log)
DescriptionMalus domestica miR7121d stem-loop
Gene family MIPF0001376; MIR7121
Literature search

1 open access papers mention mdm-MIR7121d
(1 sentences)

Stem-loop
          c       c               ccccac      ---    uu           g 
5' uauuacc ucauccu uuggugaucgcccug      ccauau   ggcc  cugaauucagg a
   ||||||| ||||||| |||||||||||||||      ||||||   ||||  ||||||||||| a
3' auaaugg aguaggg aaccauuggugggac      gguaua   ccgg  gacuuaggucu c
          c       u               -----a      cgu    --           u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC006081.961: 378-498 [-]
intergenic
Database links

Mature sequence mdm-miR7121d

Accession MIMAT0026043
Sequence

12 - 

uccucuuggugaucgcccugc

 - 32

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).