Stem-loop sequence mdm-MIR7121b

AccessionMI0023145 (change log)
DescriptionMalus domestica miR7121b stem-loop
Gene family MIPF0001376; MIR7121
Literature search

1 open access papers mention mdm-MIR7121b
(1 sentences)

Stem-loop
   caa     agac     c  --a    c   --a   a  uuac       a  c   uc                c   uau    u   g 
5'    uuccc    cugac gg   gccg cgu   gaa ua    uauuacc uc ucc  uuggugaucgcccugu gca   ggcu cug a
      |||||    ||||| ||   |||| |||   ||| ||    ||||||| || |||  |||||||||||||||| |||   |||| |||  
3'    aaggg    ggcug uc   cggu gua   cuu au    auaaugg ag agg  aaccauuagugggaca ugu   ccgg gac u
   gua     ---a     c  aaa    u   gua   a  --uu       c  u   ga                -   ---    -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009272.711: 1182-1353 [-]
intergenic
Database links

Mature sequence mdm-miR7121b

Accession MIMAT0026041
Sequence

52 - 

uccucuuggugaucgcccugu

 - 72

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).