Stem-loop sequence mdm-MIR408c

AccessionMI0023136 (change log)
DescriptionMalus domestica miR408c stem-loop
Gene family MIPF0000102; MIR408
Literature search

4 open access papers mention mdm-MIR408c
(15 sentences)

Stem-loop
      uauu    uaaugc    a     --uuaau   a       g      a     ga       cu       aaa 
5' aag    ugag      ggaa gagag       aag cagggaa agguag gcaug  uggaguu  caagagc   a
   |||    ||||      |||| |||||       ||| ||||||| |||||| |||||  |||||||  |||||||    
3' uuc    acuc      ccuu cucuc       uuc gucccuu uccguc cguac  aucucag  guucucg   u
      uccu    -uuuuu    c     ccuccgu   g       r      a     uc       -u       aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR408c

Accession MIMAT0026032
Sequence

36 - 

acagggaagagguagagcaug

 - 56

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).