Stem-loop sequence mdm-MIR408b

AccessionMI0023135 (change log)
DescriptionMalus domestica miR408b stem-loop
Gene family MIPF0000102; MIR408
Literature search

4 open access papers mention mdm-MIR408b
(15 sentences)

Stem-loop
   a              a     ga       cu       aaa 
5'  cagggaagagguag gcaug  uggaguu  caagagc   a
    |||||||||||||| |||||  |||||||  |||||||    
3'  gucccuucuccguc cguac  aucucag  guucucg   u
   g              a     uc       -u       aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC006859.349: 17335-17419 [-]
intergenic
Database links

Mature sequence mdm-miR408b

Accession MIMAT0026031
Sequence

1 - 

acagggaagagguagagcaug

 - 21

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).