Stem-loop sequence mdm-MIR828b

AccessionMI0023134 (change log)
DescriptionMalus domestica miR828b stem-loop
Gene family MIPF0000544; MIR828
Literature search

5 open access papers mention mdm-MIR828b
(97 sentences)

Stem-loop
          c        u                 uc   --cca   uuu    g   cu   a            aga   u 
5' uccucuu guaauguu cuugcucaaaugaguau  cag     cag   gcau cag  ugc uauauauauaua   aca g
   ||||||| |||||||| |||||||||||||||||  |||     |||   |||| |||  ||| ||||||||||||   |||  
3' aggagaa cauugcaa gaacggguuuacucgua  guc     guc   cgug guc  acg auauauauauau   ugu u
          -        c                 ga   cuaac   -uu    -   --   -            --g   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003205.158: 33351-33508 [+]
intergenic
Database links

Mature sequence mdm-miR828b

Accession MIMAT0026030
Sequence

17 - 

ucuugcucaaaugaguauucca

 - 38

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).