Stem-loop sequence mdm-MIR535d

AccessionMI0023131
DescriptionMalus domestica miR535d stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
      guug                           cau  c      a 
5' gau    ugugacgacgagagagagcacgcuugu   ca ccauga a
   |||    |||||||||||||||||||||||||||   || |||||| g
3' cug    auacuguuguucuuucucgugcgggca   gu gguacu g
      --aa                           uuu  u      a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (maldom-pseudo1.0) Overlapping transcripts
chr10: 17074789-17074883 [+]
intergenic

Mature sequence mdm-miR535d

Accession MIMAT0026027
Sequence

10 - 

ugacgacgagagagagcacgc

 - 30

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).