Stem-loop sequence mdm-MIR535c

DescriptionMalus domestica miR535c stem-loop
Gene family MIPF0000136; MIR535
                              cau  c      a 
5' ugugacaaggagagagagcacgcuugu   ca ccauga c
   |||||||||||||||||||||||||||   || |||||| g
3' auacuguucuucucucucguguggaca   gu gguacu g
                              uuu  u      a 
Get sequence
Feedback: Do you believe this miRNA is real?

Mature sequence mdm-miR535c

Accession MIMAT0026026

3 - 


 - 23

Get sequence
Evidence experimental; miRNAseq [1]


PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).