Stem-loop sequence mdm-MIR535b

AccessionMI0023129 (change log)
DescriptionMalus domestica miR535b stem-loop
Gene family MIPF0000136; MIR535
   gaug                              cau  c      a 
5'     uugugugacaaggagagagagcacgcuugu   ca ccauga c
       ||||||||||||||||||||||||||||||   || |||||| g
3'     ggcauacuguucuucucucucgugcgggca   gu gguacu g
   --cu                              uuu  u      a 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC005729.245: 16577-16671 [-]
Database links

Mature sequence mdm-miR535b

Accession MIMAT0026025

10 - 


 - 30

Get sequence
Evidence experimental; miRNAseq [1]


PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).