Stem-loop sequence mdm-MIR535b

AccessionMI0023129
DescriptionMalus domestica miR535b stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
   gaug                              cau  c      a 
5'     uugugugacaaggagagagagcacgcuugu   ca ccauga c
       ||||||||||||||||||||||||||||||   || |||||| g
3'     ggcauacuguucuucucucucgugcgggca   gu gguacu g
   --cu                              uuu  u      a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence mdm-miR535b

Accession MIMAT0026025
Sequence

10 - 

ugacaaggagagagagcacgc

 - 30

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).