Stem-loop sequence mdm-MIR535a

AccessionMI0023128
DescriptionMalus domestica miR535a stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
   gaug   u               a          cau  - g     a 
5'     uug gugacaacgagagag gcacgcuugu   ca c cauga a
       ||| ||||||||||||||| ||||||||||   || | ||||| g
3'     ggc uacuguuguucucuc cgugcgggca   gu g guacu g
   --cu   u               c          uuu  u -     a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence mdm-miR535a

Accession MIMAT0026024
Sequence

10 - 

ugacaacgagagagagcacgc

 - 30

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).