Stem-loop sequence mdm-MIR482c

AccessionMI0023127 (change log)
DescriptionMalus domestica miR482c stem-loop
Gene family MIPF0000403; MIR482
Literature search

4 open access papers mention mdm-MIR482c
(8 sentences)

Stem-loop
       -ua   ag -    g        uau       a     -           aacuuccuuuuur      aaa 
5' ggaa   gga  g cuuu aggagguu   ggagugg agggu aggaaagaagu             ggucuc   u
   ||||   |||  | |||| ||||||||   ||||||| ||||| |||||||||||             ||||||    
3' ccuu   ccu  u gaaa uccuuuaa   ccuuacc uccca uccuuucuuua             cuagag   u
       uuc   au r    -        cuu       c     a           -----------ag      guc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR482c

Accession MIMAT0026023
Sequence

91 - 

ucuuuccuaacccucccauucc

 - 112

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).